Emb Agar Msds-Himedia

Lab Reagents

Himedia Msds Laboratories manufactures the emb agar msds-himedia reagents distributed by Genprice. The Emb Agar Msds-Himedia reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact himedia msds. Other Emb products are available in stock. Specificity: Emb Category: Agar Group: Msds-Himedia

Msds-Himedia information

EMB Polyclonal Antibody

27429-50ul 50ul
EUR 187

EMB Rabbit pAb

A10423-100ul 100 ul
EUR 308

EMB Rabbit pAb

A10423-200ul 200 ul
EUR 459

EMB Rabbit pAb

A10423-20ul 20 ul
EUR 183

EMB Rabbit pAb

A10423-50ul 50 ul
EUR 223

Embigin (EMB) Antibody

20-abx125809
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Embigin (EMB) Antibody

20-abx318809
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Embigin (EMB) Antibody

abx232751-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

EMB cloning plasmid

CSB-CL754239HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 984
  • Sequence: atgcgcgccctccccggcctgctggaggccagggcgcgtacgccccggctgctcctcctccagtgccttctcgctgccgcgcgcccaagctcggcggacggcagtgccccagattcgccttttacaagtccacctctcagagaagaaataatggcaaataacttttccttggagag
  • Show more
Description: A cloning plasmid for the EMB gene.

Mouse Embigin (Emb)

1-CSB-CF007631MO
  • EUR 1284.00
  • EUR 558.00
  • EUR 815.00
  • 1MG
  • 200ug
  • 500ug
  • MW: 36.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Embigin(Emb) expressed in in vitro E.coli expression system

anti- EMB antibody

FNab02751 100µg
EUR 548.75
  • Immunogen: embigin homolog(Mouse)
  • Uniprot ID: Q6PCB8
  • Gene ID: 133418
  • Research Area: Signal Transduction, Developmental biology
Description: Antibody raised against EMB

Anti-EMB antibody

PAab02751 100 ug
EUR 386

Anti-EMB antibody

STJ112455 100 µl
EUR 277
Description: This gene encodes a transmembrane glycoprotein that is a member of the immunoglobulin superfamily. The encoded protein may be involved in cell growth and development by mediating interactions between the cell and extracellular matrix. A pseudogene of this gene is found on chromosome 1.

LB AGAR - LENNOX LB AGAR

L12-100-10kg 10 kg
EUR 826

LB AGAR - LENNOX LB AGAR

L12-100-2Kg 2 Kg
EUR 219

LB AGAR - LENNOX LB AGAR

L12-100-500g 500 g
EUR 96

LURIA AGAR - MILLER'S LB AGAR

L12-111-10kg 10 kg
EUR 829
Copyright © 2021 All Rights Reserved. Theme:  BlogShop