Lab Reagents
Himedia Msds Laboratories manufactures the emb agar msds-himedia reagents distributed by Genprice. The Emb Agar Msds-Himedia reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact himedia msds. Other Emb products are available in stock. Specificity: Emb Category: Agar Group: Msds-Himedia
Msds-Himedia information
EMB Polyclonal Antibody |
|
27429-50ul |
SAB |
50ul |
EUR 187 |
EMB Rabbit pAb |
|
A10423-100ul |
Abclonal |
100 ul |
EUR 308 |
EMB Rabbit pAb |
|
A10423-200ul |
Abclonal |
200 ul |
EUR 459 |
EMB Rabbit pAb |
|
A10423-20ul |
Abclonal |
20 ul |
EUR 183 |
EMB Rabbit pAb |
|
A10423-50ul |
Abclonal |
50 ul |
EUR 223 |
Embigin (EMB) Antibody |
|
20-abx125809 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Embigin (EMB) Antibody |
|
20-abx318809 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Embigin (EMB) Antibody |
|
abx232751-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
EMB cloning plasmid |
|
CSB-CL754239HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 984
- Sequence: atgcgcgccctccccggcctgctggaggccagggcgcgtacgccccggctgctcctcctccagtgccttctcgctgccgcgcgcccaagctcggcggacggcagtgccccagattcgccttttacaagtccacctctcagagaagaaataatggcaaataacttttccttggagag
- Show more
|
|
Description: A cloning plasmid for the EMB gene. |
Mouse Embigin (Emb) |
|
1-CSB-CF007631MO |
Cusabio |
-
EUR 1284.00
-
EUR 558.00
-
EUR 815.00
|
|
- MW: 36.4 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
|
Description: Recombinant Mouse Embigin(Emb) expressed in in vitro E.coli expression system |
anti- EMB antibody |
|
FNab02751 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: embigin homolog(Mouse)
- Uniprot ID: Q6PCB8
- Gene ID: 133418
- Research Area: Signal Transduction, Developmental biology
|
|
Description: Antibody raised against EMB |
Anti-EMB antibody |
|
STJ112455 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes a transmembrane glycoprotein that is a member of the immunoglobulin superfamily. The encoded protein may be involved in cell growth and development by mediating interactions between the cell and extracellular matrix. A pseudogene of this gene is found on chromosome 1. |
