Mybiosource Elisa Mouse Prss23

Lab Reagents

Human IgG antibody Laboratories manufactures the mybiosource elisa mouse prss23 reagents distributed by Genprice. The Mybiosource Elisa Mouse Prss23 reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact MyBiosource Eur. Other Mybiosource products are available in stock. Specificity: Mybiosource Category: Elisa Group: Mouse Prss23

Mouse Prss23 information

PRSS23 Antibody

1-CSB-PA018817LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRSS23. Recognizes PRSS23 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

PRSS23 siRNA

20-abx904286
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PRSS23 siRNA

20-abx930022
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PRSS23 siRNA

20-abx930023
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PRSS23 ELISA KIT|Human

EF007119 96 Tests
EUR 689

Mouse Serine protease 23, Prss23 ELISA KIT

ELI-43133m 96 Tests
EUR 865

Prss23 ORF Vector (Mouse) (pORF)

ORF055006 1.0 ug DNA
EUR 506

PRSS23 ELISA Kit (Human) (OKCD02100)

OKCD02100 96 Wells
EUR 909
Description: Description of target: This gene encodes a conserved member of the trypsin family of serine proteases. Mouse studies found a decrease of mRNA levels of this gene after ovulation was induced. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.114 ng/mL

PRSS23 Polyclonal Antibody

29975-100ul 100ul
EUR 252

PRSS23 Polyclonal Antibody

29975-50ul 50ul
EUR 187

PRSS23 Blocking Peptide

33R-9817 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PRSS23 antibody, catalog no. 70R-9165

PRSS23 cloning plasmid

CSB-CL018817HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1152
  • Sequence: atggcagggattccagggctcctcttccttctcttctttctgctctgtgctgttgggcaagtgagcccttacagtgccccctggaaacccacttggcctgcataccgcctccctgtcgtcttgccccagtctaccctcaatttagccaagccagactttggagccgaagccaaat
  • Show more
Description: A cloning plasmid for the PRSS23 gene.

PRSS23 Polyclonal Antibody

A55918 100 µg
EUR 570.55
Description: fast delivery possible

PRSS23 Rabbit pAb

A17092-100ul 100 ul
EUR 308

PRSS23 Rabbit pAb

A17092-200ul 200 ul
EUR 459

PRSS23 Rabbit pAb

A17092-20ul 20 ul
EUR 183

PRSS23 Rabbit pAb

A17092-50ul 50 ul
EUR 223
Copyright © 2021 All Rights Reserved. Theme:  BlogShop