Lab Reagents
Human IgG antibody Laboratories manufactures the mybiosource elisa mouse prss23 reagents distributed by Genprice. The Mybiosource Elisa Mouse Prss23 reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact MyBiosource Eur. Other Mybiosource products are available in stock. Specificity: Mybiosource Category: Elisa Group: Mouse Prss23
Mouse Prss23 information
PRSS23 Antibody |
|
1-CSB-PA018817LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against PRSS23. Recognizes PRSS23 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
PRSS23 siRNA |
|
20-abx904286 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PRSS23 siRNA |
|
20-abx930022 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PRSS23 siRNA |
|
20-abx930023 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Prss23 ORF Vector (Mouse) (pORF) |
|
ORF055006 |
ABM |
1.0 ug DNA |
EUR 506 |
PRSS23 ELISA Kit (Human) (OKCD02100) |
|
OKCD02100 |
Aviva Systems Biology |
96 Wells |
EUR 909 |
|
Description: Description of target: This gene encodes a conserved member of the trypsin family of serine proteases. Mouse studies found a decrease of mRNA levels of this gene after ovulation was induced. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.114 ng/mL |
PRSS23 Polyclonal Antibody |
|
29975-100ul |
SAB |
100ul |
EUR 252 |
PRSS23 Polyclonal Antibody |
|
29975-50ul |
SAB |
50ul |
EUR 187 |
PRSS23 Blocking Peptide |
|
33R-9817 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PRSS23 antibody, catalog no. 70R-9165 |
PRSS23 cloning plasmid |
|
CSB-CL018817HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1152
- Sequence: atggcagggattccagggctcctcttccttctcttctttctgctctgtgctgttgggcaagtgagcccttacagtgccccctggaaacccacttggcctgcataccgcctccctgtcgtcttgccccagtctaccctcaatttagccaagccagactttggagccgaagccaaat
- Show more
|
|
Description: A cloning plasmid for the PRSS23 gene. |
PRSS23 Polyclonal Antibody |
|
A55918 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: fast delivery possible |
PRSS23 Rabbit pAb |
|
A17092-100ul |
Abclonal |
100 ul |
EUR 308 |
PRSS23 Rabbit pAb |
|
A17092-200ul |
Abclonal |
200 ul |
EUR 459 |
PRSS23 Rabbit pAb |
|
A17092-20ul |
Abclonal |
20 ul |
EUR 183 |
PRSS23 Rabbit pAb |
|
A17092-50ul |
Abclonal |
50 ul |
EUR 223 |
