Lab Reagents

Human IgG antibody Laboratories manufactures the nipa1 antibody mybiosource reagents distributed by Genprice. The Nipa1 Antibody Mybiosource reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact MyBiosource Eur. Other Nipa1 products are available in stock. Specificity: Nipa1 Category: Antibody Group: Mybiosource

Mybiosource information

Human Magnesium transporter NIPA1, NIPA1 ELISA KIT
ELI-44030h	Lifescience Market	96 Tests	EUR 824

NIPA1 cloning plasmid
CSB-CL742399HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 765 Sequence: atggctgttggccagattggaaacttcctggcttacacggcggtccccacggtcctggtaacccccctgggcgcccttggagtaccgttcgggtccattttagcttcctatctcctgaaggaaaagctcaacatcttgggcaagttggggtgcctgctaagctgtgcaggctccgt Show more
Description: A cloning plasmid for the NIPA1 gene.

Human NIPA1 shRNA Plasmid
20-abx964733	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse NIPA1 shRNA Plasmid
20-abx982047	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

pCMV-SPORT6-NIPA1 Plasmid
PVT16286	Lifescience Market	2 ug	EUR 325

NIPA1 Recombinant Protein (Human)
RP021247	ABM	100 ug	Ask for price

NIPA1 Recombinant Protein (Mouse)
RP154127	ABM	100 ug	Ask for price

NIPA1 Recombinant Protein (Rat)
RP213947	ABM	100 ug	Ask for price

Nipa1 ORF Vector (Rat) (pORF)
ORF071317	ABM	1.0 ug DNA	EUR 506

NIPA1 ORF Vector (Human) (pORF)
ORF007083	ABM	1.0 ug DNA	EUR 95

Nipa1 ORF Vector (Mouse) (pORF)
ORF051377	ABM	1.0 ug DNA	EUR 506

NIPA1 ELISA Kit (Human) (OKCD02024)
OKCD02024	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Acts as a Mg2+ transporter. Can also transport other divalent cations such as Fe2+, Sr2+, Ba2+, Mn2+ and Co2+ but to a much less extent than Mg2+.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.059 ng/mL

Nipa1 sgRNA CRISPR Lentivector set (Rat)
K6714401	ABM	3 x 1.0 ug	EUR 339

Nipa1 sgRNA CRISPR Lentivector set (Mouse)
K3745301	ABM	3 x 1.0 ug	EUR 339

NIPA1 sgRNA CRISPR Lentivector set (Human)
K1428001	ABM	3 x 1.0 ug	EUR 339

Nipa1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6714402	ABM	1.0 ug DNA	EUR 154

Nipa1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6714403	ABM	1.0 ug DNA	EUR 154