Nipa1 Antibody Mybiosource

Lab Reagents

Human IgG antibody Laboratories manufactures the nipa1 antibody mybiosource reagents distributed by Genprice. The Nipa1 Antibody Mybiosource reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact MyBiosource Eur. Other Nipa1 products are available in stock. Specificity: Nipa1 Category: Antibody Group: Mybiosource

Mybiosource information

Human Magnesium transporter NIPA1, NIPA1 ELISA KIT

ELI-44030h 96 Tests
EUR 824

NIPA1 cloning plasmid

CSB-CL742399HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 765
  • Sequence: atggctgttggccagattggaaacttcctggcttacacggcggtccccacggtcctggtaacccccctgggcgcccttggagtaccgttcgggtccattttagcttcctatctcctgaaggaaaagctcaacatcttgggcaagttggggtgcctgctaagctgtgcaggctccgt
  • Show more
Description: A cloning plasmid for the NIPA1 gene.

Human NIPA1 shRNA Plasmid

20-abx964733
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse NIPA1 shRNA Plasmid

20-abx982047
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCMV-SPORT6-NIPA1 Plasmid

PVT16286 2 ug
EUR 325

NIPA1 Recombinant Protein (Human)

RP021247 100 ug Ask for price

NIPA1 Recombinant Protein (Mouse)

RP154127 100 ug Ask for price

NIPA1 Recombinant Protein (Rat)

RP213947 100 ug Ask for price

Nipa1 ORF Vector (Rat) (pORF)

ORF071317 1.0 ug DNA
EUR 506

NIPA1 ORF Vector (Human) (pORF)

ORF007083 1.0 ug DNA
EUR 95

Nipa1 ORF Vector (Mouse) (pORF)

ORF051377 1.0 ug DNA
EUR 506

NIPA1 ELISA Kit (Human) (OKCD02024)

OKCD02024 96 Wells
EUR 831
Description: Description of target: Acts as a Mg2+ transporter. Can also transport other divalent cations such as Fe2+, Sr2+, Ba2+, Mn2+ and Co2+ but to a much less extent than Mg2+.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.059 ng/mL

Nipa1 sgRNA CRISPR Lentivector set (Rat)

K6714401 3 x 1.0 ug
EUR 339

Nipa1 sgRNA CRISPR Lentivector set (Mouse)

K3745301 3 x 1.0 ug
EUR 339

NIPA1 sgRNA CRISPR Lentivector set (Human)

K1428001 3 x 1.0 ug
EUR 339

Nipa1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6714402 1.0 ug DNA
EUR 154

Nipa1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6714403 1.0 ug DNA
EUR 154
Copyright © 2021 All Rights Reserved. Theme:  BlogShop